View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-22 (Length: 241)
Name: NF4017-Insertion-22
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 50120811 - 50121044
Alignment:
| Q |
8 |
gtgattgcataaacaataccaataatgttgtctacaaagaagttttccacaatttctgattattgaagttccaagtatttttatattaccatttctgttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50120811 |
gtgattgcataaacaataccaataatgttgtctacaaagaagttttccacaatttcttattattgaagttccaagtatttttatattaccatttctgttg |
50120910 |
T |
|
| Q |
108 |
tatccgaccaaatctaacgttcctacatcttaattacaatattcaactatttttattgagttaatgtttatgacccttgccgcaagggtaaaatatctag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50120911 |
tatccgaccaaatctaacgttcctacatcttaattacaatattcaactatttttattgagttaatgtttatgacccttgccgcacgggtaaaatatctag |
50121010 |
T |
|
| Q |
208 |
tgtttccaatctcaataacacattaatttagcta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
50121011 |
tgtttccaatctcaataacacattaatttagcta |
50121044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University