View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-23 (Length: 231)
Name: NF4017-Insertion-23
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 46932837 - 46933061
Alignment:
| Q |
7 |
attattaagacttggtcttttgactttagractagagagcctatattattatttattattgaacaaatcatggagtttgacaatatcatattaattttta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932837 |
attattaagacttggtcttttgactttagaactagagagcctatattatttattattattgaacaaatcatggagtttgacaatatcatattaattttta |
46932936 |
T |
 |
| Q |
107 |
gtgtttaacaaatcatgtataaatagagcttcttagtaacattaacatgcatcaaaccaacatttcctctcttgtactcaatttctctcattatttatca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932937 |
gtgtttaacaaatcatgtataaatagagcttcttagtaacattaacatgcatcaaaccagcatttcctctcttgtactcaatttctctcattatttatca |
46933036 |
T |
 |
| Q |
207 |
actattcacacacacattacattca |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46933037 |
actattcacacacacattacattca |
46933061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University