View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-28 (Length: 135)
Name: NF4017-Insertion-28
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 48749070 - 48749199
Alignment:
| Q |
6 |
catcattagcaccttcgtccacagcttcaatgatgaatcactcatcatggcactcaccaattccttacctttttggaggcttagcagccatgttaggtct |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48749070 |
catcattagcaccttcatccacagcttcaatgatgaatcactcatcatggcactcaccaattccttacctttttggaggcttagcagccatgttaggtct |
48749169 |
T |
|
| Q |
106 |
catagcttttgcactgttaattttagcttg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48749170 |
catagcttttgcactgttaattttagcttg |
48749199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 44 - 126
Target Start/End: Complemental strand, 53701452 - 53701370
Alignment:
| Q |
44 |
cactcatcatggcactcaccaattccttacctttttggaggcttagcagccatgttaggtctcatagcttttgcactgttaat |
126 |
Q |
| |
|
|||||| ||||||| |||||| |||| ||| | || || || |||||||||||||||||| | ||||||||||| || ||||| |
|
|
| T |
53701452 |
cactcaccatggcattcaccagttccatacttgttcggtggtttagcagccatgttaggtttaatagcttttgctctattaat |
53701370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University