View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-30 (Length: 115)
Name: NF4017-Insertion-30
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 34746458 - 34746566
Alignment:
| Q |
7 |
actaacggtcaacttctttctggttactatactatgtatagaagtttccaaaatcacatggattgaacatgtcattggttggcttaacaccatataattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34746458 |
actaacggtcaacttctttctggttactatactatgtatagaagtttccaaaatcacatggattgaacatgtcattggttggcttaacaccataaaattt |
34746557 |
T |
 |
| Q |
107 |
ggagaaata |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
34746558 |
ggagaaata |
34746566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University