View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017-Insertion-33 (Length: 102)
Name: NF4017-Insertion-33
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017-Insertion-33 |
 |  |
|
| [»] chr1 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 5e-47; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 12175283 - 12175377
Alignment:
| Q |
8 |
tcattttcatcgatcaatatacaatagtttcaaagtaagttataagaaaatgaattccaaagggttactttttctagctatgctcttggcttcca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12175283 |
tcattttcatcgatcaatatacaatagtttcaaagtaagttataagaaaatgaattccaaagggttactttttctagctatgctcttggcttcca |
12175377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 12188257 - 12188329
Alignment:
| Q |
8 |
tcattttcatcgatcaatatacaatagtttcaaagtaagttataagaaaatgaattccaaagggttactttttct |
82 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12188257 |
tcattttcatcgatcaata--caatagtttcacaataagctataagaaaatgaattccaaagggttactttttct |
12188329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 12182252 - 12182324
Alignment:
| Q |
8 |
tcattttcatcgatcaatatacaatagtttcaaagtaagttataagaaaatgaattccaaagggttactttttct |
82 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12182252 |
tcattttcatcgatcaata--caatagtttcacgataagctataacaaaatgaattccaaagggttactttttct |
12182324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 102
Target Start/End: Original strand, 12149469 - 12149518
Alignment:
| Q |
53 |
gaaaatgaattccaaagggttactttttctagctatgctcttggcttcca |
102 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||| | |||||||||| |
|
|
| T |
12149469 |
gaaaatgaattccaaggcgttactttttctagccatgttgttggcttcca |
12149518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 102
Target Start/End: Complemental strand, 12146339 - 12146291
Alignment:
| Q |
54 |
aaaatgaattccaaagggttactttttctagctatgctcttggcttcca |
102 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| | |||||||||| |
|
|
| T |
12146339 |
aaaatgaattccaaggctttactttttctagctatgttgttggcttcca |
12146291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University