View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_high_22 (Length: 363)
Name: NF4017_high_22
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 22 - 341
Target Start/End: Complemental strand, 11904738 - 11904416
Alignment:
| Q |
22 |
ttagtacgggtcgttgaagtgacaacttgagagttgcatcgcttcagtgcctgagcattttgacgcgtgtctctatggctacgtttaacttacgtagcaa |
121 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11904738 |
ttagtacgggtcattgaagtgacaacttgagagttgcatcgcttcagtgccggagcattttgacgcgtgtctctgtggctacgtttaacttaagtagcaa |
11904639 |
T |
|
| Q |
122 |
tttgaaggtttctttttagaggcgcaatttcaacacttggatttgatggtgtaagatcatattgtttgatcgtaataagtgcctccgagtcattccctac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11904638 |
tttgaaggtttctttttagaggcgcaatttcaacacttgaatttgatggtgtaagatcatattgtttgatcgtaataagtgcctccgagtcattccctac |
11904539 |
T |
|
| Q |
222 |
cgtagaaga---atggttcactcgatttgaatatataccttttatatttccttttttgcctatttgaatatatgaccagagccaccatgtgagagtcgtg |
318 |
Q |
| |
|
||||||||| ||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11904538 |
cgtagaagaatgatggttcccttgatttgaatatgtaccttttatatttccttttttgcctatttgaatatatgaccagagccaccatgtgagagtcgtg |
11904439 |
T |
|
| Q |
319 |
tctttcatagcaattgcaaccat |
341 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11904438 |
tctttcatagcaattgcaaccat |
11904416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University