View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_high_38 (Length: 250)
Name: NF4017_high_38
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 8885697 - 8885603
Alignment:
| Q |
1 |
aattgcaatggacataacaaagctggtccgaaggagagagttgttgctgttgttgctggtccggtgaaaaggaagtggatgatgaagaggacatg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885697 |
aattgcaatggacataacaaagctggtccgaaggagagagttgttgctgttgttgctggtccggtgaaaaggaagtggatgatgaagaggacatg |
8885603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 172 - 240
Target Start/End: Complemental strand, 8885526 - 8885458
Alignment:
| Q |
172 |
gggattgactgatcagtgaagtttcttgggtgtgtgatatgatagatagatagatataaacttcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885526 |
gggattgactgatcagtgaagtttcttgggtgtgtgatatgatagatagatagatataaacttcctatg |
8885458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University