View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_high_41 (Length: 249)
Name: NF4017_high_41
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9896916 - 9896682
Alignment:
| Q |
1 |
attactatcatgtggtttagattagaatctagcatattaatagcttctgatgcaatacaaatgcattcaaatatgtttctatatttaactaaccctctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9896916 |
attactatcatgtggtttagattagaatctagcatattaatagcttctgatgcaatacaaatgcattcaaatatgtttctatatttaactaaccctctaa |
9896817 |
T |
 |
| Q |
101 |
tcatttttggaacaattaaggcaagctgatcaacaagaaccctttaagaattgtagaacacgagcttcaataaataaatttgactctaaaaaatatca-- |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9896816 |
tcatttttggaacaattaaggcaagctgatcaacaagaaccctttaagaattgtagaacacgagcttcaat-aataaatttgactctaaaaaatatcatc |
9896718 |
T |
 |
| Q |
199 |
-tcagatttaagaactgaaatctgcttggaagctgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9896717 |
ttcagatttaagaactgaaatctgcttggaagctgt |
9896682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University