View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_low_26 (Length: 342)
Name: NF4017_low_26
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 11 - 329
Target Start/End: Complemental strand, 36767471 - 36767147
Alignment:
| Q |
11 |
cagagacaacaatggtgaaaagagccctatcttgattcaaaccaacagctaatgactcaatgttgtatcctcttcttgcgaacactccagctattcggtt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767471 |
cagaaacaacaatggtgaaaagagccctatcttgattcaaaccaacagctaatgactcaatgttgtatcctcttcttgcgaacactccagctattcggtt |
36767372 |
T |
 |
| Q |
111 |
aatcattccactctcatcaccaacgaacaccgaaatcgtgtgtctccgaactctgcagcattatcaataatcaatcaattaattaatcacaaatcagaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767371 |
aatcattccactctcatcaccaacgaacaccgaaatcgtgtgtctccgaactctgcagcattatcaataatcaatcaattaattaatcacaaatcagaat |
36767272 |
T |
 |
| Q |
211 |
attagtctaattgattagagaatacttactttgatcgagaaggtgaaggag------gagggccgttggaggagacggtggtgtcaccggaagtagcagc |
304 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767271 |
attagtataattgattagagaatacttactttgatcgagaaggtgaaggaggaggaggagggccgttggaggagacggtggtgtcaccggaagtagcagc |
36767172 |
T |
 |
| Q |
305 |
ggcggagaggatgaggttgttgttg |
329 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36767171 |
ggcggagaggatgaggttgttgttg |
36767147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University