View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_low_27 (Length: 337)
Name: NF4017_low_27
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 55 - 328
Target Start/End: Original strand, 2361075 - 2361348
Alignment:
| Q |
55 |
ttgagattgagattcttcaccggagtttgccggtaacggtaatgacggaagaggaatttcattttccggtggtggtgatgataactgacacgtggcagct |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361075 |
ttgagattgagattcttcaccggagtttgccggtaacggtaatgacgaaagaggaatttcattttccggtggtggtgatgataactgacacgtggcagct |
2361174 |
T |
|
| Q |
155 |
gcacttacaggtggagttatgaaattagttagcgcgtctggtccacgcaacttaatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361175 |
gcacttacaggtggagttatgaaattagttagcgcgtctggtccacgcaacttaatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaa |
2361274 |
T |
|
| Q |
255 |
atgtaccaagccacacacgcactccacgcgccgggtctcttatctccgccgcccattttccccatggtctctgc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361275 |
atgtaccaagccacacacgcactccacgcgccgggtctcttatctccgccgcccattttccccatggtctctgc |
2361348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 41747998 - 41747958
Alignment:
| Q |
287 |
gggtctcttatctccgccgcccattttccccatggtctctg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41747998 |
gggtctcttatctccgccgcccattttccccaaggtctctg |
41747958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 261
Target Start/End: Complemental strand, 41197611 - 41197538
Alignment:
| Q |
188 |
gcgtctggtccacgcaacttaatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaaatgtacc |
261 |
Q |
| |
|
|||||||||||||| | ||||||||| || ||||| || || |||||||||||||| || |||| ||| ||||| |
|
|
| T |
41197611 |
gcgtctggtccacgaagcttaatagcggcattgtcataaaccatagcagcttcttctgcagtttcaaaagtacc |
41197538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 327
Target Start/End: Original strand, 43490153 - 43490190
Alignment:
| Q |
290 |
tctcttatctccgccgcccattttccccatggtctctg |
327 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43490153 |
tctcttatctctgctgcccattttccccatggtctctg |
43490190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University