View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4017_low_35 (Length: 293)
Name: NF4017_low_35
Description: NF4017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4017_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 34746183 - 34746425
Alignment:
| Q |
11 |
cagagagattcttggcttggaaagcaatgaagagaaagtggcagaaagatggtgttttagggaatctgctgatgaggagaatattaagttaagggtagat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34746183 |
cagagagattcttggcttggaaagcaatgaagagaaagtggcagaaagatggtgttttagggaatctgctgatgaggagaatattaagttaagggtagat |
34746282 |
T |
 |
| Q |
111 |
tgcagagaaccaattagagagag-nnnnnnnnntacaaaatcataatatatagtgctgtgtttgcacgcatgtacttc-------------atgttcatg |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34746283 |
tgcagagaaccaattagagagagaaaaaaacaatacaaaatcataatatatagtgctgtgtttgcacgcatgtacttcatgttcatgttttatgttcatg |
34746382 |
T |
 |
| Q |
197 |
acttcaagttgaagctcatatcatgttagtgtggcaaaaattc |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34746383 |
acttcaagttgaagctcatctcatgttagtgtggcaaaaattc |
34746425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 31052718 - 31052682
Alignment:
| Q |
13 |
gagagattcttggcttggaaagcaatgaagagaaagt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31052718 |
gagagattcttggcttggaaagcaatgaaaagaaagt |
31052682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University