View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_high_14 (Length: 372)
Name: NF4020_high_14
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 149 - 356
Target Start/End: Original strand, 29020342 - 29020549
Alignment:
| Q |
149 |
taatatgatgattttttaaggcatcaaccactagctttgagtcacattcaaaacaaaaattatgtcaattattctgatttgcaattttgatagcatgcat |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29020342 |
taatattatgattttttaaggcatcaaccactagctttgagtcacattcaaaacaaaaattatgtcaattattctgattagcaattttgatagcatgcat |
29020441 |
T |
 |
| Q |
249 |
agttgtcactaatttaacaaagagagaaatttagagcccctatagttgtgccaccagtgttagctttgatccaagcagcatggggaaggaagaaataacc |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29020442 |
agttgtcactaatttaacaaagagagaaatttagagcccctatagttgtgccaccagtgttagctttgatccaagcagcatggggaaggaagaaataacc |
29020541 |
T |
 |
| Q |
349 |
cttctatg |
356 |
Q |
| |
|
|||||||| |
|
|
| T |
29020542 |
cttctatg |
29020549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 29020298 - 29020344
Alignment:
| Q |
18 |
tatactaaaactttttaacttatcggcacaacaaatttcctccctaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29020298 |
tatactaaaactttttaacttatcggtacaacaaatttcctccctaa |
29020344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University