View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_high_15 (Length: 368)
Name: NF4020_high_15
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 181 - 351
Target Start/End: Complemental strand, 35937380 - 35937210
Alignment:
| Q |
181 |
gctttgaataagtgctgcaaaaattaaaaccaagtattattgttgttcataaaaacgatcattgnnnnnnnnagggaaaaaacaatcattgttgttatcc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35937380 |
gctttgaataagtgctgcaaaaattaaaactaagtattattgttgttcttaaaaacgatcattgttttttttagggaaaaaacaatcattgttgttatcc |
35937281 |
T |
 |
| Q |
281 |
attatttataatccctcttttactgttttgtaaattaatatatagattttttatgaggagtggttacgttt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35937280 |
attatttataatccctcttttactgttttgtaaattaatatatagattttttatgaggagtggttacgttt |
35937210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 66 - 120
Target Start/End: Complemental strand, 35937495 - 35937441
Alignment:
| Q |
66 |
taagaatatgttctaaccaaaatgtttggtagatatccgatatgtatatagactt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35937495 |
taagaatatgttctaaccaaaatgtttggtagatatccgatatgtatatagactt |
35937441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University