View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_high_21 (Length: 282)
Name: NF4020_high_21
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 44837225 - 44837499
Alignment:
| Q |
13 |
acctgtgctaccccacactgaaagagaccattggannnnnnnctaccggtgagatggggagtacttttccatgagtttagccaagtcctcatcaaacttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44837225 |
acctgtgctaccccacactgaaagagaccattggatttttttctaccggtgagatggggagtacttttccatgagtttagccaagtcctcatcaaacttc |
44837324 |
T |
 |
| Q |
113 |
ttctccatctcttcctcttcctcccagtgcctcttcctcatagcagcaatcccctcttcgtgggcttggcttagt---------------------ttct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
44837325 |
ttctccatctcttcctcttcctcccagtgcctcttcctcatagcagcaatactctcttcgtgggcttggcttagtttctccttttcttcaacaaagttct |
44837424 |
T |
 |
| Q |
192 |
ccatttctttgtcttgaagttcaacaaatttaaggtatccctccaccctacatccaaaaagatcaaattcattgt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44837425 |
ccatttctttgtcttgaagttcaacaaatttaaggtatccctccaccctacatccaaaaagatcaaattcattgt |
44837499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 21 - 265
Target Start/End: Original strand, 44848851 - 44849114
Alignment:
| Q |
21 |
taccccacactgaaagagaccattggannnnnnnctaccggtgagatggggagtacttttccatgagtttagccaagtcctcatcaaacttcttctccat |
120 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44848851 |
taccccccactgaaagagaccattgg-cctttttctactggtgagatggggagtacttttccatgagtttggccaagtcctcatcaaacttcttctccat |
44848949 |
T |
 |
| Q |
121 |
ctcttcctcttcctcccagtgcctcttcctcatagcagcaatcccctcttcgtgggcttggcttagtt---------------------tctccatttct |
199 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||| | |||||| || |||||||| || | ||||||||||| |
|
|
| T |
44848950 |
ctccacctcttcctcccagtgcctcttcttcatagcagcaatgctctcttcatgagcttggctgagcttctccttttcatcgacaaagctctccatttct |
44849049 |
T |
 |
| Q |
200 |
ttgtcttgaagttcaacaaatttaaggtatccctccaccctacatccaaaaagatcaaattcattg |
265 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44849050 |
ttgtcttggagttcgacaaatttaaggtatccctccaccctac-tccaaagagatcaaattcattg |
44849114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University