View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_low_21 (Length: 290)
Name: NF4020_low_21
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 4 - 277
Target Start/End: Original strand, 38483654 - 38483927
Alignment:
| Q |
4 |
agatggagaaattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagttttttcgatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38483654 |
agatggagaaattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatg |
38483753 |
T |
|
| Q |
104 |
gaaatcgtgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttca |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483754 |
gaaatcgtgttgggaagacgggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttca |
38483853 |
T |
|
| Q |
204 |
agtggcgattattgttggttggaatgatagagcttatccttggcgtgcggtgatggaggaacgcgatttgcagg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483854 |
agtggcgattattgttggttggaatgatagagcttatccttggcgtgcggtgatggaggaacgcgatttgcagg |
38483927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Original strand, 3682860 - 3682910
Alignment:
| Q |
6 |
atggagaaattatgatgatataaatgagtatttttggagtaagaggtgttt |
56 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3682860 |
atggaggaattatgatgatataaatgagtatttttggagtaggaggtgttt |
3682910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 30118047 - 30118257
Alignment:
| Q |
7 |
tggagaaattatgatgatataaatgagtatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagtttttt-------- |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||| |||| | ||||||| |||||| |
|
|
| T |
30118047 |
tggagaaattatgatgatattaatgagtatttttggagtaggaggtgttttgagaagatgaaatggcctcctgatgttgggagtaatttttttactactg |
30118146 |
T |
|
| Q |
99 |
----cgatggaaatcgtgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgatttt |
194 |
Q |
| |
|
| || || | |||||| ||||| || |||||||| | ||| |||||||||||| ||||| |||||||||| ||||||||| | |||||| | || |
|
|
| T |
30118147 |
ttggtaaggggaaacatgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgtt |
30118246 |
T |
|
| Q |
195 |
gtttcttcaag |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
30118247 |
gtttcttcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University