View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_low_25 (Length: 226)
Name: NF4020_low_25
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_low_25 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 1714954 - 1714742
Alignment:
| Q |
14 |
ctagattaaattgatattgaataatttgaacctatgatgcaggaagagttggaaaaacttgaaacaataggtgaatcttccacagtctgcaatgagtaag |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1714954 |
ctagaataaattgatattgaataatttgaacctatgatgcaggaagagttggaaaaacttgaaacaataggtgaatcttccacagtctgcaatgagtaag |
1714855 |
T |
|
| Q |
114 |
caaagcaaaaacaaatactttttaaattagatttgtgctatttttcatcattgaatggtccattcattgtgcttttaattaatttgcagtgtcatttcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1714854 |
caaagcaaaaacaaatactttttaaattagatttgtgctatttttcatcattgaatggtccattcattgtgcttttaattaatttgcagtgtcatttcaa |
1714755 |
T |
|
| Q |
214 |
gcgttgaatccat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1714754 |
gcgttgaatccat |
1714742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University