View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4020_low_26 (Length: 225)
Name: NF4020_low_26
Description: NF4020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4020_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 25536644 - 25536443
Alignment:
| Q |
16 |
ttaatgcattcgttcgtcacaagacccttttagtgacactagttcatataatgcccaagtagtcttgaatttcttacaatgacttttttatcattcaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25536644 |
ttaatgcattcgttcgtcacaagacccttttagtgacactagttcatataatgcccaagtagtcttgaatttcttacaatgacttttttatcattcaaat |
25536545 |
T |
 |
| Q |
116 |
gattttatctgctatttggagtagttataattaattgtagttccagcttctaagctatggaaatagcttctggtatctaattcacttgtgcatcacaggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25536544 |
gattttatctgctatttggagtagttataattaattgtagttccagcttctaagctatggaaatagcttctggtatctaattcacttgtgcatcacgggt |
25536445 |
T |
 |
| Q |
216 |
tc |
217 |
Q |
| |
|
|| |
|
|
| T |
25536444 |
tc |
25536443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University