View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4021_high_6 (Length: 399)
Name: NF4021_high_6
Description: NF4021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4021_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 169 - 389
Target Start/End: Original strand, 41752532 - 41752752
Alignment:
| Q |
169 |
tttagaatcatattcatcttcatccgtgaaactcttattgtttatggttccactcataatagttgctggtctagtttctgtgttgggtcctaatccttct |
268 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41752532 |
tttagaatcatattcatcttcatccatgaaactcttattgtttatggttccactcataatagttgctggtctagtttccgtgttgggtcctaatccttct |
41752631 |
T |
 |
| Q |
269 |
aattggacttctattccaaactcaagtggtgatgatgttacaacaaaaactatggagaaggctcaacttgttgtggctgctgctgttgattttcataaca |
368 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41752632 |
aattggacttctattccaaacccaagtggtgatgatgttacaacaaaaactatggagaaggctcaagttgttgtggctgctgctgttgattttcataaca |
41752731 |
T |
 |
| Q |
369 |
aagaagtcaaagctatctctg |
389 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41752732 |
aagaagtcaaagctatctctg |
41752752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 41752374 - 41752477
Alignment:
| Q |
19 |
aatttattaccaagattcttcctataaatactatcccaccaaaaacttctctgttttaatcctcccctacttctactcttctctctttcttaatttctcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41752374 |
aatttattaccaagattcttcctataaatactatcccaccaaaaacttctctgttttaatcctcccctacttctactcttctctcttttttaatttctcc |
41752473 |
T |
 |
| Q |
119 |
cacc |
122 |
Q |
| |
|
|||| |
|
|
| T |
41752474 |
cacc |
41752477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University