View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4021_high_9 (Length: 251)
Name: NF4021_high_9
Description: NF4021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4021_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 7290258 - 7290496
Alignment:
| Q |
3 |
tattcttgatgcaagttgatgataatcgtcttttggtatgttgggcagaattatgcacaaacatactttaggtaaaataaacttatcttttatgtcttgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
7290258 |
tattcttgatgcaagttgatgataatcgtcttttggtatgtttggcagaattatgcacaaacatactttaggtaaaataaacttgtcttttatgccttgc |
7290357 |
T |
 |
| Q |
103 |
atggtagtgccttcaaggtccaagttatggttgatgtaaggttacattacagtgctattttgatttatagggagtgacaaaccaaaaagttcattatata |
202 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7290358 |
atggtggtgccttcaaggtccaagttatggttgatttaaggttacattacattattattttgatttatagggagtgacaaaccaaaaagttcattatata |
7290457 |
T |
 |
| Q |
203 |
tagacataacaaatcacaatagaaaaatacggccctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7290458 |
tagacataacaaatcacaatagaaaaatatggccctttg |
7290496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University