View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4021_low_13 (Length: 239)
Name: NF4021_low_13
Description: NF4021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4021_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38912985 - 38912764
Alignment:
| Q |
1 |
caactgaattaatcataaattgcgggtgtacnnnnnnntagatgtctatcaaacnnnnnnnnnactagaagcacttcaatatgaagagagtggtctttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38912985 |
caactgaattaatcataaattgcgggtgttcaaaaaaatagatgtctatcaaactttttttttactagaagcacttcaatatgaagagagtggtctttgg |
38912886 |
T |
 |
| Q |
101 |
cataaaggtgggggctttgtggaaggttctaatgcagccacgaggttatccctctctttaaggcttccgctgacgtggcaatagccacgagttggttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38912885 |
cataaaggtgggggctttgtggaaggttctaatgcagccacgaggttatccctctctttaaggcttccgctgacgtggcaatagccacgagttgcttgtt |
38912786 |
T |
 |
| Q |
201 |
aagtgtaaacagcattggtgac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38912785 |
aagtgtaaacagcattggtgac |
38912764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University