View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4021_low_9 (Length: 281)
Name: NF4021_low_9
Description: NF4021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4021_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 23517598 - 23517384
Alignment:
| Q |
1 |
tttgtgtgttttcttcatatgggctttcaatttgttcattaatcaatggatcctttaactgtcagtaaccaaaaaactactatcttgcattgctttcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23517598 |
tttgtgtgttttcttcatatgggctttcaacttattcattaatcaatggatcctttaactgtcaataaccaaaaaactactatcatgcattgctttcaga |
23517499 |
T |
 |
| Q |
101 |
tgtggttaatgttaaaaaacatgaaaaattctgatccttannnnnnnnnnnnccatttctatgttactgtcattttaacaatgttgtcttgtgtttgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23517498 |
tgtggttaatgttaaaaaacatgaaaaattctgatccttatttttgttttttccatttctatgttactgtcattttaacaatgttgtcttgtgtttgctt |
23517399 |
T |
 |
| Q |
201 |
atcttaagctttgtt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23517398 |
atcttaagctttgtt |
23517384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University