View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4022_low_3 (Length: 246)
Name: NF4022_low_3
Description: NF4022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4022_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 34261112 - 34261337
Alignment:
| Q |
6 |
gaatttggcaaaaccacattgataaaagctacattttttagcttcaataaaatcacggtgccactgtggttttctcaaactcaacaaactcattgtcaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34261112 |
gaatttggcaaaaccacattgataaaagctacattttttagcttcaataaaatcacggtgccactgtggttttgtcaaactcaacaaactcattgtcaga |
34261211 |
T |
|
| Q |
106 |
gtgcatgttagaattgacggtatatttgacagaattacagcgtatcactgtgattttgacaaaaaagttggcatcaacacagttactgtgtcatcttgat |
205 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
34261212 |
gtgcatgtttgagttgacggtatatttgacagaattacagcgtgtcactgtgaatttgacaaaaaagttggcatcaacacagttacagtgtcatcctgat |
34261311 |
T |
|
| Q |
206 |
ttcgtcaaactcaatgtgatttcaaa |
231 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
34261312 |
ttcgtcaaactcactgtgatttcaaa |
34261337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 78
Target Start/End: Original strand, 3643729 - 3643778
Alignment:
| Q |
29 |
aaaagctacattttttagcttcaataaaatcacggtgccactgtggtttt |
78 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
3643729 |
aaaagctacactttgtagcttcaataaaatcatggtgtcactgtgatttt |
3643778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University