View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4023_low_4 (Length: 312)

Name: NF4023_low_4
Description: NF4023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4023_low_4
NF4023_low_4
[»] chr5 (1 HSPs)
chr5 (16-53)||(33143913-33143950)


Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 33143913 - 33143950
Alignment:
16 atataaactataaatccctataattaacaatatatgaa 53  Q
    ||||||||||||||||||||||||||||||||||||||    
33143913 atataaactataaatccctataattaacaatatatgaa 33143950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University