View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4023_low_7 (Length: 255)
Name: NF4023_low_7
Description: NF4023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4023_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 49906710 - 49906929
Alignment:
| Q |
14 |
tactctctccttttcaaaattttgattgttgaagagctttgttattactactactacacggaaagtgacatccatgtactcaacgctgcatgcaataagg |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49906710 |
tactctctccttttcaaaattttgagtgttgaagagctttgttattactactagtacacggaaagtgacatccatgtactcaacgctgcatgcaataagg |
49906809 |
T |
|
| Q |
114 |
agggccagacaatacataccttttattgcatgcataatcaggtgaggaaattgttaaaaactgtaaccggtcgtataaaatacgatgtttgtgtttgatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49906810 |
agggccagacaatacataccttttattgcatgcataatcaggtgaggaaattgttaaaaaatgtaaccggtcgtataaaatacgatgtttgtgtttga-- |
49906907 |
T |
|
| Q |
214 |
gtgttgtgtgtttctatatctttat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49906908 |
---ttgtgtgtttctatatctttat |
49906929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University