View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4024_high_6 (Length: 265)
Name: NF4024_high_6
Description: NF4024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4024_high_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 265
Target Start/End: Original strand, 38555698 - 38555952
Alignment:
| Q |
11 |
cagagacaggttgcaatgctaatttagagtctttaagtgatgatcgggacaagattgaggcaactgcagtggacatagcaactgacgtggtcaatgtaat |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38555698 |
cagagacaggttgcaatgctagtttagagtctttaagtgatgatcgggacaagattgaggcaactgcagtagacacagcaactgacgtggtcaatgtaat |
38555797 |
T |
|
| Q |
111 |
aagtgaaattgtggctcagaaaacggacaatgaacctgccgatcctctggtatagtttcttagataatttgttgtgcattacattaacctgaacataggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38555798 |
aagtgaaattgtggctcagaaaacggacaatgaacctgccgatcctctggtatagtttcttagatattttgttgtgcattacattaacctgaacataggt |
38555897 |
T |
|
| Q |
211 |
cgattgcatggttgttgctggtggatctggtttatacaaatattaggctccatat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38555898 |
cgattgcatggttgttgctggtggatctggtttatacaaatattaggctccatat |
38555952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University