View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4024_high_9 (Length: 237)
Name: NF4024_high_9
Description: NF4024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4024_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 32475040 - 32475250
Alignment:
| Q |
15 |
tttttaaagagagaactgaggttaagagagaagaggtacaacttggatagatgac---atatacaaatttgatattttattattaattaaaatgatccga |
111 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32475040 |
tttttaaaaagagaacagaggttaagagagaagaggtacaacttggatggatgacgacatatacaaatttgatattttattattaattaaaatgatccga |
32475139 |
T |
 |
| Q |
112 |
tatgttatactcnnnnnnntccaaatgaatgagtcaaaactatatgaagtactgtaaaggacaaatatttcgctgctagatttttatttagattttgatt |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32475140 |
tatgttatactcaaaaaagtccaaatgaatgagtcaaaactatatgaagtaccgtaaaggacaaatatttcgctgctagatttttatttagattttgatt |
32475239 |
T |
 |
| Q |
212 |
ccatgcaatct |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
32475240 |
ccatgcaatct |
32475250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University