View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4024_low_4 (Length: 307)
Name: NF4024_low_4
Description: NF4024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4024_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 145 - 299
Target Start/End: Original strand, 38556089 - 38556243
Alignment:
| Q |
145 |
gttcttttcactgtttccgaaaacaccagattgctcacaacctacatatggttattgaaatgaaaattgccacattttggaaacatttttgggaagtaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38556089 |
gttcttttcactgtttccgaaaacaccaggttgctcacaacctacatatggttattgaaatgaaaattgacacattttggaaacatttttgggaagtaaa |
38556188 |
T |
|
| Q |
245 |
tggtccttagttttatgtatgtagattggggaatattaaaatggttttgatgatg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38556189 |
tggtccttagttttatgtatgtagattggggaatattaaaatggttttgatgatg |
38556243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 38555945 - 38556045
Alignment:
| Q |
1 |
ctccatataccatttcctgtttccattcctaaaataaacaatgaacgtaaactgtaaaaacatgcttgcctttgaccagctgttctcattgtgaatttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38555945 |
ctccatataccatttcctgtttccattcctaaaattatcaatgaacgtgaactgtaaaaacatgtttgcctttgaccagctgttctcattgtgaatttca |
38556044 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
38556045 |
g |
38556045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University