View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4025_high_12 (Length: 297)
Name: NF4025_high_12
Description: NF4025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4025_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 32605170 - 32604907
Alignment:
| Q |
19 |
cggaaggggttagactttcaaaacatggtgaatcaatattgtgtaggaaaaaacattgattccataataaacataaaatcagattctagtaattgatcgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605170 |
cggaaggggttagactttcaaaacatggtgaatcaatattgtgtaggaaaaaacattgattccataataaacataaaatcagattctagtaattgatcgg |
32605071 |
T |
 |
| Q |
119 |
aatatgggctcgttttggaaaatggataagggaatctctaagatgaaaaattgaggtgagagagttagtgccattaattaagtgccggtggtgtgtgaaa |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32605070 |
aatatgggcttgttttggaaaatggataagggaatctctaaggtgaaaaattgaggtgagagagttagtgccattaattaagtgccggtgttgtgtgaaa |
32604971 |
T |
 |
| Q |
219 |
ctggggcttctcttttttaaataattagcttttttggcctatataaagcctattttgcattttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604970 |
ctggggcttctcttttttaaataattagcttttttggcctatataaagcctattttgcattttg |
32604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University