View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4025_low_7 (Length: 376)
Name: NF4025_low_7
Description: NF4025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4025_low_7 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 178 - 376
Target Start/End: Complemental strand, 1647415 - 1647217
Alignment:
| Q |
178 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647415 |
cattgaattaatgggaaattgagcgagatactgaccgttataacaacaccgccaccattcttttggcctaaagtgagaccaagtggcttgtcaacctcag |
1647316 |
T |
 |
| Q |
278 |
cttcaattgtctttgaagcaccagcagttcttgcagtgatctcaagtctctttctagcaatggaggaggaacaacttttgttgtcacctaggaaggatc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
1647315 |
cttcaattgtctttgaagcaccagcagttcttgcagtgatctcaagtctctttctagcaatggaggaggaaccacttttgttgtcacctaggaacgatc |
1647217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 6 - 132
Target Start/End: Complemental strand, 1647553 - 1647417
Alignment:
| Q |
6 |
cacagacaaggatatcagacataggaaacaacactgaca----------aataatgttttgagaacgtgaaatattggaatttaaccatatgtgtcggtg |
95 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1647553 |
cacagacaaggatattagacataggacacaacactgacacatcgacgcaaataatattttgagaacgtgaaatattggaatttaaccatatgtgtcagtg |
1647454 |
T |
 |
| Q |
96 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1647453 |
tcgtgtcgcttatgtcggataccagacatgccttcaa |
1647417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University