View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4026_high_7 (Length: 380)
Name: NF4026_high_7
Description: NF4026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4026_high_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 205 - 380
Target Start/End: Complemental strand, 13183994 - 13183818
Alignment:
| Q |
205 |
cgcagtccaaacgcacgtttcactcttcaaacgcagtttttcaatttcataagatgtttgggcagaatcaaattcggatctgaaaaagtgattcaaccac |
304 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13183994 |
cgcagtccaaacgcatgtttcactcttcaaacgcagtttttcaatttcataagatgtttggccagaatcaaacgcggatctgaaaaagtgattcaaccac |
13183895 |
T |
|
| Q |
305 |
caaaacgcgagtacactagaagccacaaatcgtagcttctgcggcagcac-aaatcgattttggatttcttttttgg |
380 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13183894 |
caaaacgcgagtccactagaagccaccaatcgtagcttctgcggcagcacaaaatcgattttggatttcttttttgg |
13183818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 46 - 181
Target Start/End: Complemental strand, 8186952 - 8186816
Alignment:
| Q |
46 |
gacctaaattgtagaaatttgcagaaacccaatatcaataagtagtaaagtttcggaatttactatatactgaccaaggctaacttccatggttg-tttc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
8186952 |
gacctaaattgtagaaatttgcagaaacccaatatcaataagtagtaaagtttcggaatttactatatactgacgaaggttaacttccatggttgttttc |
8186853 |
T |
|
| Q |
145 |
ttcagcacgtggcaacttgggtaaacgccaaaacggt |
181 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8186852 |
ttcagcacgtgacaacttgggtaaacgccaaaacggt |
8186816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 181 - 235
Target Start/End: Original strand, 4517787 - 4517841
Alignment:
| Q |
181 |
tgtgtctgtttggttcggcgtttccgcagtccaaacgcacgtttcactcttcaaa |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4517787 |
tgtgtttgtttggttcggcgtttccgcagtccaaacgcacgtttcactcttcaaa |
4517841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University