View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4026_low_11 (Length: 262)
Name: NF4026_low_11
Description: NF4026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4026_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 262
Target Start/End: Original strand, 2968808 - 2969053
Alignment:
| Q |
15 |
agttttaagggttgtaataaaaataaactttgctgaaactatagtttttatcttttatcttcattgaatctgaaagaaacaagtattgcttcatcccatt |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2968808 |
agttttaagggttgttataaaaataaactttgctgaaactatagtttttatcttttatcttcattgaatctgaaagaaacaagtattgcttcatcccatt |
2968907 |
T |
 |
| Q |
115 |
tgccaacatcagaaggtgaaaatttgatgattattttcaagaaaagcctttcaaacatgtcacacaaatatattttattgatagtgtgaaacactaatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2968908 |
tgccaacatcagaaggtgaaaatttgatgattattttcaagaaaagcctttcaaacatgt--cacaaatatattttattgatagtgtgaaacactaatta |
2969005 |
T |
 |
| Q |
215 |
agacaatacaaggctccacaagtttacctaaactcattctatcacaaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2969006 |
agacaatacaaggctccacaagtttacctaaactcattctatcacaaa |
2969053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University