View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4029_high_4 (Length: 376)
Name: NF4029_high_4
Description: NF4029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4029_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 4 - 361
Target Start/End: Original strand, 42340128 - 42340485
Alignment:
| Q |
4 |
aatctttctaaatcctccaccggttcagtgtccgttcatgatttgaatcgttttatagaaacttactttcatgctgctggtcatgatctcgtgtactctg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42340128 |
aatctttctaaatcctccaccggttcagtgtccgttcatgatttgaatcgttttatagaaacttactttcatgctgcaggtcatgatctcgtgtactctg |
42340227 |
T |
|
| Q |
104 |
atccagaggattttgtccctgagcctgagggttttttgcctaaagtgaaaaaccctgaggtcagagcatgggcaattaaagttcattctctttggaaaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42340228 |
atccagaggattttgtccctgagcctgatggttttttgcctaaagtgaaaaaccctgaggtcagagcatgggcaattaaggttcattctctttggaaaaa |
42340327 |
T |
|
| Q |
204 |
tttgagtaggaaagtatccagtgaggtcaagactcatcctaactaccatactctgcttcctgttcctggttctgttgttattcctggctcgcgatttcgt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42340328 |
tttgagtaggaaagtatccagtgaggtcaagactcatcctaactaccatactctgcttcctgttcctggttctgttgttattcctggctctcgatttcgt |
42340427 |
T |
|
| Q |
304 |
gaagtttattactgggattcctactgggtaattaggtttgtttcttccttttttactc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340428 |
gaagtttattactgggattcctactgggtaattaggtttgtttcttccttttttactc |
42340485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University