View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4029_high_5 (Length: 268)
Name: NF4029_high_5
Description: NF4029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4029_high_5 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 180 - 268
Target Start/End: Original strand, 19765149 - 19765237
Alignment:
| Q |
180 |
ctaaattggatcataatcacattatgtattgttgattgtgtctgaaattggtctcttgaatacgatttctttggtttgtcttatatatc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19765149 |
ctaaattggatcataatcacattatgtattgttgattgtgtctgaaattggtctcttgaatacgatttctttggtttgtcttatatatc |
19765237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 19764980 - 19765068
Alignment:
| Q |
11 |
gattattcttcatgaacaatcatgggttctagagaaaagttgtaaaaatcaaatttttatactatgttgatgatgccttgtgaatgaag |
99 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19764980 |
gattattcttcataaacaatcataggttctagaaaaaagttgtaaaaatcaaatttttatactatgttgatgatgccttgtgaatgaag |
19765068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 19764865 - 19764923
Alignment:
| Q |
11 |
gattattcttcatgaa-caatcatgggttctagagaaaagttgtaaaaatcaaattttt |
68 |
Q |
| |
|
||||||||||||| || |||| ||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
19764865 |
gattattcttcataaaacaataatgggttcttgagaaaacttgtaaaaatcaatttttt |
19764923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 394430 - 394518
Alignment:
| Q |
11 |
gattattcttcatgaacaatcatgggttctagagaaaagttgtaaaaatcaaatttttatactatgttgatgatgccttgtgaatgaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394430 |
gattattcttcatgaacaatcatgggttctagagaaaagttgtaaaaatcaaatttttatactatgttgatgatgccttgtgaatgaag |
394518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 195 - 261
Target Start/End: Original strand, 394611 - 394677
Alignment:
| Q |
195 |
atcacattatgtattgttgattgtgtctgaaattggtctcttgaatacgatttctttggtttgtctt |
261 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
394611 |
atcacattatgtatttttgactgtgtctgaaattggtctcttgaatatgatttctttggtttgtctt |
394677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University