View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4029_low_8 (Length: 234)
Name: NF4029_low_8
Description: NF4029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4029_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19765604 - 19765824
Alignment:
| Q |
1 |
tcatacacattactaacaggctggtggccatggtgcaacaagcgaaacatggagtagaaaagatgataaggaacaatgggtcgaccctaaagttgtcccg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19765604 |
tcatacgcattactaacaggctggtggccatggtgcaacaagcgaaacatggagtagaaaagatgataaggaacaatgggtcgaccctaaagttgtcccg |
19765703 |
T |
|
| Q |
101 |
gaatgtctgtcatcacatttaaaaagttgtgatctttacacattcttaggccttgaaggagagcttcatctagcatgctacatattgaagaatgcaagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19765704 |
gaatgtctgtcatcacatttaaaaagttgcgatctttacacattcttaggccttgaaggagagcttcatctagcatgctacatattgaagaatgcaagag |
19765803 |
T |
|
| Q |
201 |
ttttggaagagatgatgatat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19765804 |
ttttggaagagatgatgatat |
19765824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University