View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_18 (Length: 365)
Name: NF4030_high_18
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 145 - 349
Target Start/End: Complemental strand, 15540996 - 15540783
Alignment:
| Q |
145 |
gattcgttgatgcggcagtggtatgcta--gctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct |
242 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15540996 |
gattcgttgatgcggcagtgtaatgctatagctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct |
15540897 |
T |
 |
| Q |
243 |
cttgacagt-------gnnnnnnnncaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaaccataaccgtctccgtgaa |
335 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15540896 |
cttgacagtgaaagtggtgaaaaaacaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaaccataaccgtctccgtgaa |
15540797 |
T |
 |
| Q |
336 |
tccaacatagaatg |
349 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15540796 |
tccaacatagaatg |
15540783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University