View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_19 (Length: 365)
Name: NF4030_high_19
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 26959773 - 26959619
Alignment:
| Q |
19 |
tatctagtatcatgttcctgtcttgctattctctctgcgttatttctcatccataataaccaaaaacaatctttctccttgttatcatcatcatcaaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26959773 |
tatctagtatcatgttcctgtcttgctattctctctgcgttatttctcatccataataaccaaaaaccatctttctccttgttatcatcatcatcaaact |
26959674 |
T |
|
| Q |
119 |
ctaaccgttatggttctggaacagatagaatttggcctgtaaatttttcttactc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26959673 |
ctaaccgttatggttctggaacagatagaatttggcctgtaaatttttcttactc |
26959619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 245 - 358
Target Start/End: Complemental strand, 26959546 - 26959433
Alignment:
| Q |
245 |
caggaattggaacctagttggaaacttgttttggccacagttattggnnnnnnnggatcagcatgtggaaccgttggtggtgttggtggtggtggcattt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26959546 |
caggaattggaacctagttggaaacttgttttggccacagttattggtttttttggatcagcatgtggaaccgttggtggtgttggtggtggtggcattt |
26959447 |
T |
|
| Q |
345 |
ttgttcctatgctt |
358 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26959446 |
ttgttcctatgctt |
26959433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 245 - 358
Target Start/End: Original strand, 41775006 - 41775119
Alignment:
| Q |
245 |
caggaattggaacctagttggaaacttgttttggccacagttattggnnnnnnnggatcagcatgtggaaccgttggtggtgttggtggtggtggcattt |
344 |
Q |
| |
|
||||||||| | |||||||||| ||||| ||||||| || ||||||| ||||| || | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41775006 |
caggaattgaagcctagttggagacttgctttggcctcaattattggttttctaggatctgcttttggaaccgttggtggtgttggtggtggtggcattt |
41775105 |
T |
|
| Q |
345 |
ttgttcctatgctt |
358 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
41775106 |
ttgttcccatgctt |
41775119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University