View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_34 (Length: 280)
Name: NF4030_high_34
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 264
Target Start/End: Complemental strand, 16565306 - 16565042
Alignment:
| Q |
9 |
agcaaagggacattccatcattcctagcnnnnnnngtactttattaaacaattaaagtcgatattaaaggcttaaagcaacccatgcatgcccaccaatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16565306 |
agcaaagggacattccatcattcctagcaaaaaaagtactttattaaacaattaaagtcgatattaaaggcttaaagcaacccatgcatgcccaccaatg |
16565207 |
T |
 |
| Q |
109 |
caactgcaatgatggcactcagagtggaaatggagtcttttaagggtaaaaagcttataaaaacaattatgacaacgaatttgatcttagtttgtcatat |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16565206 |
caactgcaatgatggcactgagagtggaaatggagtcttttaagggtaaaaagcttataaaaacaattatgacaacgaatttgatcttagtttgtcatat |
16565107 |
T |
 |
| Q |
209 |
tggtgcatgat---------atattgcacagaactgtagttaaatatgacttatattattgcaat |
264 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16565106 |
tggtgcatgatatatgatatatattgcacaaaactgtagttaaatatgacttatattattgcaat |
16565042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 82 - 149
Target Start/End: Complemental strand, 52822524 - 52822457
Alignment:
| Q |
82 |
aaagcaacccatgcatgcccaccaatgcaactgcaatgatggcactcagagtggaaatggagtctttt |
149 |
Q |
| |
|
||||||||| |||||| |||||||| || ||||||| ||| |||| ||||||||| ||||||||||| |
|
|
| T |
52822524 |
aaagcaacctatgcatccccaccaactcagctgcaataatgacactaagagtggaagtggagtctttt |
52822457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University