View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_41 (Length: 258)
Name: NF4030_high_41
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 37795275 - 37795025
Alignment:
| Q |
1 |
ttttgccatttgttctctttcaagaaggtaatatattactagaaattttttaatcttgtctatcctcaccacattgataattgttctaatcatatgttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37795275 |
ttttgccatttgttctctttcaagaaggtaatatattactagaatttttttaatcttgtctatcctcaccacattgataattgttctaatcatatgtata |
37795176 |
T |
|
| Q |
101 |
tgatttacaattgtttttgtaaatcaaattattaattataagtaaattatatatatcactactttcttctaatgacttattatgatggacaacaagtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37795175 |
tgatttacaattgtttttgtaaatcaaattattaattataagtaaattatatatatcactactttcttctaatgacttattatgattgacaacaagtttt |
37795076 |
T |
|
| Q |
201 |
aaatgttcatattgctgccccatgtccgttttgggttgtgttcctttgctt |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
37795075 |
aaatgttcatattgctgccccatatccgtgttgggttgtgttccattgctt |
37795025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University