View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_45 (Length: 252)
Name: NF4030_high_45
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 25934440 - 25934675
Alignment:
| Q |
1 |
gtagaaagagtggtgtaatggaaattgatggaagcagctacaataggcgtgtgttttcactaagagagagtgattttaaaggcatggatgagtctagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25934440 |
gtagaaagagtggtgtaatggaaattgatggaagcagctacaataggcgtgtgttttcactaagagagagtgattttaaaggcatggatgagtctagttt |
25934539 |
T |
 |
| Q |
101 |
tattgatttaaagcttgattattcatctgaattaaaaatggcagatacactctcagcttttggaagcataagaggtggaaatttcatgacacatgatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25934540 |
tattgatttaaagcttgattattcatctgaattaaaaatggcagatacactctcagcttttggaagcataagaggtggaaatttcatgacacatgatgct |
25934639 |
T |
 |
| Q |
201 |
ggtggcggtggcggtggtggtgatggaggttcatgt |
236 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25934640 |
ggtggcggtggtggtggaggtgatggaggttcatgt |
25934675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 16704043 - 16703920
Alignment:
| Q |
1 |
gtagaaagagtggtgtaatggaaattgatggaagcagctacaataggcgtgtgttttcactaagagagagtgattttaaaggcatggatgagtctagttt |
100 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
16704043 |
gtaggaagagtggtgttatggaaattgatggaagc---tacaacaggcgtctgttttcactaagagagagtgattttaaaggcatggatgaatctcgttt |
16703947 |
T |
 |
| Q |
101 |
tattgatttaaagcttgattattcatc |
127 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
16703946 |
tattgatttgaagcttgattattcatc |
16703920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University