View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_61 (Length: 207)
Name: NF4030_high_61
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 4043760 - 4043576
Alignment:
| Q |
13 |
taagaaataaaagacccatccaactaatcataaggttgtaaatgaagtcgtaagttttatgataaaaatgatgtgatggaagactagggatgatcattgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4043760 |
taagaaataaaagacccatccaactaatcataaggttgtaaatgaagtcgtaagttttatgataaaaatgatgtgatggaagactaaggatgatcattgt |
4043661 |
T |
 |
| Q |
113 |
cgcagcaactacgtatgaataggcaaatgtggtcagaactatccacattccgaaagacagtaaccatatgattactctgtgctcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
4043660 |
cgcagcaactacgtatgaataggcaaatgtggtcagaactatccacattccgaaagacagcaaccatatgattactcggtgctcc |
4043576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University