View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_high_63 (Length: 204)
Name: NF4030_high_63
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 8003199 - 8003375
Alignment:
| Q |
11 |
tagcaaaggttgaatttccaccttcattccttccaacacgaactactattggcatcctcaactctctcaccaactgccgtttccagtgaaagataattgt |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003199 |
tagcaaaggttgaacttccaccttcattccttccaacacgaactactattggcatcctcaactctctcaccaactgccgtttccagtgaaagataattgt |
8003298 |
T |
 |
| Q |
111 |
cagccacaagttccgttagccgccgtgatgctcataaccatgcctagtcttccagtaacaaagttccccgcatactt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003299 |
cagccacaagttccgttagccgccgtgatgctcataaccatgcctagtcttccagtaacaaagttccccgcatactt |
8003375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 48
Target Start/End: Complemental strand, 30517888 - 30517851
Alignment:
| Q |
11 |
tagcaaaggttgaatttccaccttcattccttccaaca |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
30517888 |
tagcaaaggttgaacttccaccttcattccttcaaaca |
30517851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University