View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_23 (Length: 348)
Name: NF4030_low_23
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 204 - 332
Target Start/End: Original strand, 43658406 - 43658534
Alignment:
| Q |
204 |
ttatttgaaatgggactttatggagataattgttacaaaacctattgtgtaattccccctctcaccaaatgctccaaataagcatagtacatgcacctga |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43658406 |
ttatttgaaatgggactttatggagataattgttacaaaacctattgtgtaattccccctctcaccaaatgctccaaataagcatagtacatgcacctga |
43658505 |
T |
 |
| Q |
304 |
taaatgatttctagaccaaaagaaggaag |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43658506 |
taaatgatttctagaccaaaagaaggaag |
43658534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University