View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_31 (Length: 301)
Name: NF4030_low_31
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 49765523 - 49765237
Alignment:
| Q |
1 |
gtagagtcttcagtgttcagaactaagaagtcctctatggcataatggtacnnnnnnngagat-gggggagtggagaagaagaaaatctcgatgcattct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49765523 |
gtagagtcttcagtgttcagaactaagaagtcctctatggcataatggtactttttttgagatggggggagtggagaagaagaaaatctcgacgcattct |
49765424 |
T |
 |
| Q |
100 |
ctgtcatcacgtggcttgtcttaattactactatgacattggttgtagtannnnnnngtagctaccttattgtaatgcacactatggtcatggtggtgtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49765423 |
ctgtcatcacgtggcttgtcttaattactactatgacattggttgtagtatttttttgtagctaccttattgtaatgcacactatggtcatggtggtgtt |
49765324 |
T |
 |
| Q |
200 |
cacatgcatacacatgtttgggtagtgtagagacaatacggagtacctacatagaatcacttttggcttgtatcattgagtttatat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49765323 |
cacatgcatacacatgtttgggtagtgtagagacaatacggagtacctacatagaatcacttttggcttgtatcattgagtttatat |
49765237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University