View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_37 (Length: 273)
Name: NF4030_low_37
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 3 - 257
Target Start/End: Complemental strand, 16565010 - 16564752
Alignment:
| Q |
3 |
tatttttgtggtattcttcttaaaatattcataattaactatactataatttctctattaaatcaatcattttctcaaaatgcacaaaaaa-cagatcga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16565010 |
tatttttgtggtattcttcttaaaatattcataattaactatactataatttttctattaaatcaatcattttctcaaaatgcacaaaaaaacagatcga |
16564911 |
T |
 |
| Q |
102 |
aagacatctaaattttgtctttgttgcaattgcagttgtaaatatggttctaaatttgaggtttagtcacacttgcaattaaactctagggtacggaaga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16564910 |
aagacatctaaattttgtctttgttgcaattgcagttgtaaatatggttctaaatttgaggtttagtcacacttgcaattaaactctagggtacggaaga |
16564811 |
T |
 |
| Q |
202 |
tgtcaccatcattaaaatttccttgcaaatgtgaag---agtggataggatgatatata |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16564810 |
tgtcaccatcattaaaatttccttgcaaatgtgaagggtggtggataggatgatatata |
16564752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University