View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_45 (Length: 254)
Name: NF4030_low_45
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 3426548 - 3426329
Alignment:
| Q |
19 |
ctgtttacctacataacacacaatatttagaaccaacaagctcatgtaatcttatcctcgatgtatgttgacatttttgaagcataacatgaagttgata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3426548 |
ctgtttacctacataacacacaatatttagaaccaacaagctcatgtaatcttatcctcgatgtatgttgacatttttgaagcataacacgaagttgata |
3426449 |
T |
 |
| Q |
119 |
cttggatatgatcactctttcttgtcatgtgtctggtcctagtaggtgtggttagtaatctttggagtgttcattgtatttcatttggttgggttttagc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3426448 |
cttggatatgatcactctttcttgtcatgtgtctggtcctagtaggtgtggttagtaatctttggagtgttcattgtatttcttttggttgggttttagc |
3426349 |
T |
 |
| Q |
219 |
atgcccactccgtcgtctgt |
238 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
3426348 |
atgcccactccctcgtctgt |
3426329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University