View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_50 (Length: 250)
Name: NF4030_low_50
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 45252709 - 45252601
Alignment:
| Q |
1 |
atttgcaactatttttatcattgtgtagctagagaatttttgtgaggttgtaagctagagtatgtcaatatatttgctaacatatacttttaaaaaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45252709 |
atttgcaactatttttatcattgtgtagctagagaatttttgagaggttgtaagctagagtatgtcaatatatttgctaacatatacttttaaaaaacac |
45252610 |
T |
 |
| Q |
101 |
ttaaagaat |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
45252609 |
ttaaagaat |
45252601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 240
Target Start/End: Complemental strand, 45252510 - 45252471
Alignment:
| Q |
201 |
tttcaatacaatatttctatatcataattcaactcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45252510 |
tttcaatacaatatttctatatcataattcaactcctatg |
45252471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University