View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_57 (Length: 235)
Name: NF4030_low_57
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 45252789 - 45252998
Alignment:
| Q |
21 |
gaattaaaaaagaaaattcttttacaaatattggttgttgattcttgttccatttttggtgtttaaaacaatactctnnnnnnnntactcacaaat---- |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45252789 |
gaattaaaaaagaaaattcttttacaaatattggttgttgattcttgttccatttttggtgtttaaaacaatactctaaaaaaaatactcacaaattaat |
45252888 |
T |
 |
| Q |
117 |
----------tcgtcatgattaagtacaacaatttaagaattttgaattttgaagagtatatatatatttaaggaaggaagtgaggtaatgaatgggtta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
45252889 |
taattaatactcgtcatgattaagtacaacaatttaagaattttgaa-----gagtatatatatatatttaagaaagaaagtgaggtaatgaatgggtta |
45252983 |
T |
 |
| Q |
207 |
gttagatgatggaag |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45252984 |
gttagatgatggaag |
45252998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University