View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_58 (Length: 234)
Name: NF4030_low_58
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_58 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
| [»] scaffold0793 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 12114589 - 12114369
Alignment:
| Q |
1 |
tctatggattttcttctcatctctcatgctcatatggatcacattgttagttccttatttactactttctttattttcattgttaatgctatcttatt-- |
98 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12114589 |
tctatggattttcttttgatctctcatgctcatatggatcacattgttagtttcttatttactactttctttattttcattgttaatgctatcttatttt |
12114490 |
T |
|
| Q |
99 |
---catcatttttgcacttttcttttacataatcttggattggttgcttatttgctgtttttgtatgacatgtactcttctatgaagcacggatacggtc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| | | |
|
|
| T |
12114489 |
gatcatcatttttgcacttttcttttacataattttggattggttgcttatttgctgtttttgtatgatatgtactcatctatgaagcacggatagtgac |
12114390 |
T |
|
| Q |
196 |
acggacacgacacattttatt |
216 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
12114389 |
acggacacgacaaattttatt |
12114369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41016809 - 41016758
Alignment:
| Q |
1 |
tctatggattttcttctcatctctcatgctcatatggatcacattgttagtt |
52 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
41016809 |
tctatggattttcttttgatctctcatgctcatatggatcacattgttagtt |
41016758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41018552 - 41018501
Alignment:
| Q |
1 |
tctatggattttcttctcatctctcatgctcatatggatcacattgttagtt |
52 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
41018552 |
tctatggattttcttttgatctctcatgctcatatgtttcacattgttagtt |
41018501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 23370 - 23405
Alignment:
| Q |
174 |
tctatgaagcacggatacggtcacggacacgacaca |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23370 |
tctatgaagcacggatacggacacggacacgacaca |
23405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0793 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0793
Description:
Target: scaffold0793; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 4993 - 4957
Alignment:
| Q |
174 |
tctatgaagcacggatacggtcacggacacgacacat |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
4993 |
tctatgaagcacggatacagacacggacacgacacat |
4957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 753043 - 753007
Alignment:
| Q |
174 |
tctatgaagcacggatacggtcacggacacgacacat |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
753043 |
tctatgaagcacggatacagacacggacacgacacat |
753007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University