View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4030_low_63 (Length: 207)

Name: NF4030_low_63
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4030_low_63
NF4030_low_63
[»] chr4 (1 HSPs)
chr4 (13-197)||(4043576-4043760)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 4043760 - 4043576
Alignment:
13 taagaaataaaagacccatccaactaatcataaggttgtaaatgaagtcgtaagttttatgataaaaatgatgtgatggaagactagggatgatcattgt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
4043760 taagaaataaaagacccatccaactaatcataaggttgtaaatgaagtcgtaagttttatgataaaaatgatgtgatggaagactaaggatgatcattgt 4043661  T
113 cgcagcaactacgtatgaataggcaaatgtggtcagaactatccacattccgaaagacagtaaccatatgattactctgtgctcc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||    
4043660 cgcagcaactacgtatgaataggcaaatgtggtcagaactatccacattccgaaagacagcaaccatatgattactcggtgctcc 4043576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University