View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_64 (Length: 207)
Name: NF4030_low_64
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 188
Target Start/End: Original strand, 18645867 - 18646047
Alignment:
| Q |
8 |
agcagaatcataggtctcttaacttttctctgtttaatgtataatctcta-gtttccgactctatcatttcgcatgattgaccagggcataatggcacca |
106 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645867 |
agcataatcctaggtctct-aacttttcattgtttaatgtataatttctaagtttccgactctatcatttcgcatgattgaccagggcataatggcacca |
18645965 |
T |
|
| Q |
107 |
tagatggacaaggacgcacgtggtggacaaaatatcgccagaatcttctcaacgatacaagggggccacttgttcagatcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18645966 |
tagatggacaaggacgcacgtggtggacaaaatatcgccagaatcttctcaaccatacaagggggccacttgttcagatcat |
18646047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 89 - 188
Target Start/End: Original strand, 18638800 - 18638899
Alignment:
| Q |
89 |
cagggcataatggcaccatagatggacaaggacgcacgtggtggacaaaatatcgccagaatcttctcaacgatacaagggggccacttgttcagatcat |
188 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||| || |||||||||||| ||| ||| || |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
18638800 |
cagggcataatggtaccataaatggacagggacaaacatggtggacaaaacatctccataagcttctcaattacacaagggggccacttgttcagatcat |
18638899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 79 - 188
Target Start/End: Complemental strand, 51839598 - 51839490
Alignment:
| Q |
79 |
catgattgaccagggcataatggcaccatagatggacaaggacgcacgtggtggacaaaatatcgccagaatcttctcaacgatacaagggggccacttg |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||| | ||||||| ||||| ||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
51839598 |
catgattgac-agggcataatggcaccataaatggacaaggacaggcatggtggaaaaaatttcgccagaagcgtctcaactatacaagggggccacttc |
51839500 |
T |
|
| Q |
179 |
ttcagatcat |
188 |
Q |
| |
|
|||||||||| |
|
|
| T |
51839499 |
ttcagatcat |
51839490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University